Journal: Blood Advances

Article Title: Unexpected diagnosis of WHIM syndrome in refractory autoimmune cytopenia

doi: 10.1182/bloodadvances.2024013301

Figure Lengend Snippet: Patient characterization. (A) Serum immunoglobulin titer (IgM and IgG) in P1 show reduced serum IgG and, with IVIG replacement, serum IgM levels dramatically increased. The timing of rituximab and IVIG infusions is shown. (B) Family pedigree. Patients are indicated. (C) Bone marrow aspirate from P1 showing myelokathexis: arrows show degenerative changes and hypersegmentation of mature neutrophils. (D) Schematic representation of signaling pathways activated downstream of the CXCR4 receptor and the effect of the mutations.

Article Snippet: Briefly, cells were transfected with a plasmid expressing a single-guide RNA specific for CXCR4 (GCCGTGGCAAACTGGTACTT), CRISPR–associated protein 9, enhanced green fluorescent protein (GFP), and puromycin (VectorBuilder, VB190718-1161ybg) following the calcium phosphate method (for HEK 293T cells; Sigma-Aldrich), or by electroporation for the NALM6 B cells.

Techniques: Protein-Protein interactions

Journal: Blood Advances

Article Title: Unexpected diagnosis of WHIM syndrome in refractory autoimmune cytopenia

doi: 10.1182/bloodadvances.2024013301

Figure Lengend Snippet: The signaling tail of CXCR4 and position of other mutants

Article Snippet: Briefly, cells were transfected with a plasmid expressing a single-guide RNA specific for CXCR4 (GCCGTGGCAAACTGGTACTT), CRISPR–associated protein 9, enhanced green fluorescent protein (GFP), and puromycin (VectorBuilder, VB190718-1161ybg) following the calcium phosphate method (for HEK 293T cells; Sigma-Aldrich), or by electroporation for the NALM6 B cells.

Techniques:

Journal: Blood Advances

Article Title: Unexpected diagnosis of WHIM syndrome in refractory autoimmune cytopenia

doi: 10.1182/bloodadvances.2024013301

Figure Lengend Snippet: Functional assays in CXCR4 variants: impaired termination of CXCR4 signaling. (A) CXCR4 phosphorylation. HEK-293T cells expressing CXCR4 WT or mutants were stimulated with 100 nM rhCXCL12 for 20 minutes, and 1, 3, and 6 hours, and the whole-cell lysates were analyzed by western blot (WB) to determine CXCR4 phosphorylation (Ser324/325) and total CXCR4 levels; β-actin was used as loading control. Data show a representative WB of 4 independent experiments. (B) Stable WT and mutant CXCR4 NALM6 cells were stimulated with 100 nM rhCXCL12 for 30 minutes, and 1, 3, and 6 hours, and the surface expression of CXCR4 was measured by flow cytometry (left panel). (C) Data are expressed as precent (%) of remaining surface CXCR4. Values represent mean ± standard deviation of 5 independent experiments.

Article Snippet: Briefly, cells were transfected with a plasmid expressing a single-guide RNA specific for CXCR4 (GCCGTGGCAAACTGGTACTT), CRISPR–associated protein 9, enhanced green fluorescent protein (GFP), and puromycin (VectorBuilder, VB190718-1161ybg) following the calcium phosphate method (for HEK 293T cells; Sigma-Aldrich), or by electroporation for the NALM6 B cells.

Techniques: Functional Assay, Phospho-proteomics, Expressing, Western Blot, Control, Mutagenesis, Flow Cytometry, Standard Deviation

Journal: Blood Advances

Article Title: Unexpected diagnosis of WHIM syndrome in refractory autoimmune cytopenia

doi: 10.1182/bloodadvances.2024013301

Figure Lengend Snippet: Functional assays in CXCR4 variants: enhanced receptor activation and prolonged intracellular signaling. (A) cAMP production was determined in stable NALM6 cells expressing WT CXCR4 (CXCR4 WT ) or CXCR4 variants, after 30 minutes of stimulation in the presence of CXCL12; data represent mean ± standard error of the mean (SEM) of 4 independent experiments. (B) NALM6 cells were serum starved for 4 hours and stimulated with 100 nM rhCXCL12 for 10, 20, or 30 minutes, and ERK1/2 phosphorylation (T202/Y204) was measured by flow cytometry and represented as mean fluorescent intensity (MFI) fold change from baseline. Values represent mean ± SEM of 5 independent experiments. Comparisons are made to WT. ∗ P < .05 (2-tailed unpaired Students t test). (C) Calcium mobilization was determined in WT and CXCR4 mutant NALM6 cells. Measurements were taken every second before and after ligand binding, for 2 minutes. Values represent mean ± SEM of 3 experimental triplicates of 5 independent experiments. (D) Right panel shows the area under the curve (AUC) of calcium mobilization, calculated for each cell line. ∗ P < .05; ∗∗ P < .01 (2-tailed unpaired Student t test). (E) Chemotaxis assay in transwells. Data show the fold of migrated cells to the lower chamber for 4 hours compared with WT. (F) NALM6 cells were serum starved for 4 hours and stimulated with 100 nM rhCXCL12 for 10, 20, or 30 minutes, and AKT phosphorylation (S473) was measured by flow cytometry and represented as MFI fold change from baseline. Values represent mean ± SEM of 5 independent experiments. Comparisons are made with WT. ∗ P < .05; ∗∗ P < .01 (2-tailed unpaired Student t test).

Article Snippet: Briefly, cells were transfected with a plasmid expressing a single-guide RNA specific for CXCR4 (GCCGTGGCAAACTGGTACTT), CRISPR–associated protein 9, enhanced green fluorescent protein (GFP), and puromycin (VectorBuilder, VB190718-1161ybg) following the calcium phosphate method (for HEK 293T cells; Sigma-Aldrich), or by electroporation for the NALM6 B cells.

Techniques: Functional Assay, Activation Assay, Expressing, Phospho-proteomics, Flow Cytometry, Mutagenesis, Ligand Binding Assay, Chemotaxis Assay

Journal: Journal of Nanobiotechnology

Article Title: Short cell-penetration peptide conjugated bioreducible polymer enhances gene editing of CRISPR system

doi: 10.1186/s12951-024-02554-w

Figure Lengend Snippet: TSP scp promotes gene activation activity of CRISPR-dCas system. ( A ) Activation of mNG expression by mCherry-dCas12f-VPR/sgRNA targeting mNG promoter in the HEK293T reporter cells after TSP scp /pDNA, TSP/pDNA, PEI/pDNA and Lipo/pDNA transfection. In the non-targeted (NT) sgRNA control, cells transfected with a non-targeted sgRNA. Fluorescence imaging and flow cytometry analysis were performed 48 h post transfection. Red, mCherry-dCas12f-VPR. Green, mNG. VPR (VP64-p65-Rta), a transcriptional activator. Scale bar, 250 μm. ( B ) Schematic analysis of endogenous gene activation by CRISPR-dCas12a delivered by TSP scp and other transfection reagents. ( C-D ) qPCR analysis of targeted genes including HBG, IL1RN and TTN, in TSP scp /pDNA, TSP/pDNA, PEI/pDNA and Lipo/pDNA transfected cells. RNA extraction was performed 48 h post transfection. n = 3 per group. Data represents as mean ± SD, ∗ P < 0.05, ∗∗ P < 0.01, ∗∗∗ P < 0.001, ∗∗∗∗ P < 0.0001. P -values are from ANNOVA analysis and Sidak’s multiple comparisons test

Article Snippet: Plasmids expressing single guide RNA (sgRNA) were constructed by ligating the corresponding annealed oligos to the basic plasmid under the human U6 promoter (GENEWIZ, China).

Techniques: Activation Assay, Activity Assay, CRISPR, Expressing, Transfection, Fluorescence, Imaging, Flow Cytometry, RNA Extraction